Recent orders
Another climate change paper
Another climate change paper
I plan on writing about Yellowstone national park. A place that I believe is important for a number of reasons. Yellowstone was the first national park in the US, founded in 1872 by Ulysses S Grant. Yellowstone is essentially the birthplace of nature preservation for Americans.The park represents the beauty we find in nature in it’s least human dominated form. National parks in general remind us how we should be making efforts at protecting our planet, appreciating it and giving back to it not only taking away. With industrialization comes rapid CO2 emission, need for deforestation, as well as a host of other negative environmental side effects.
The theme I’d like to focus on regarding Yellowstone is climate change. How is climate change affecting yellowstone? Being a national park means there is a lot of recent data, papers regarding the health of yellowstone, and groups dedicated to making preservation a larger effort not only keeping industrialization away from yellowstone but reducing the human carbon footprint as a whole. So why not add my paper to the stack? There’s no harm in increasing awareness, keeping the faith that humanity will soon realize it’s being called to action! The goal of the paper then is to make the data from Yellowstone contribute to awareness of the broader issue of climate change by interpreting data from a natural science perspective and a humanitarian one. Simultaneously remaining pragmatic and research oriented. The first park in the US, the beauty we consciously preserve for citizens to drive through and feel good, will it’s relevance be enough to take at least some climate change sceptics to the other side?
A source I plan on using is nps.gov(National Park Service). Looking at the website briefly I see information about how climate change is affecting Yellowstone both entirely and detailed information regarding flora and fauna. This source should prove useful because it provides quantitative and qualitative observation as well as information on the importance of preservation. There’s a large portion of the website dedicated to “Why it Matters”.
English Renaissance and Reformation
Name
Institution
Course
Date
English Renaissance and Reformation
The Government
The English Reformation was characterized by various events that happened during 16th century in HYPERLINK “http://en.wikipedia.org/wiki/England” o “England” England whereby the HYPERLINK “http://en.wikipedia.org/wiki/Church_of_England” o “Church of England” England Church charged away from the Pope’s authority and the HYPERLINK “http://en.wikipedia.org/wiki/Catholic_Church_in_England_and_Wales” o “Catholic Church in England and Wales” Catholic Church. During this period, the events were associated with European Protestant reformation, which was a political, and a religious movement, which affected Christianity practices in most European nations (Fix, 12). Some of the factors that influenced the process included, the feudalism decline, nationalism rise, printing press invention, common law uprising and the continued bible circulation. However, some English Reformation phases, which covered Ireland and Wales, were influenced by government policy changes whereby the public opinions accommodated itself gradually.
Religion
Religion a major aspect of Renaissance has been changing considerably over the past centuries. Before Renaissance thus during the middle Ages, most Churches especially the Catholic Church was on the increase in many parts of Europe. To the Catholic, the Pope was the most feared and influential person. At this particular time, Church was considered the community life center. As the Renaissance began to flourish, the church was still considered as a center of life. Most people in the community would still refuge in church during wars and plague. However, things had begun to change and various aspects were against the influence of the church in the community. The re-awakening of the Renaissance was characterized by the rebirth of thought. In this case, many people started taking up their own opinions and views regarding the world. Additionally, most people were beginning to question the Pope and the Church (Rowse, 45) .Some of the facts, which played an important role in weakening the influence of the Church, included Humanism rise, Printing Press invention and corruption awareness in the church. Individual Reformers work was also a key aspect during this period.
Social Class
The English Elizabethan Era was characterized by the daily life which was based on social order aspects. During this period, the monarch was considered as the most highest while the nobility was seen as the second highest rank. The gentry, merchants, yeomanry, and the laborers followed respectively. To the English, the queen was seen as a God’s representation on earth. This particular group of people believed that God formed and blesses most of these social ranks (Estep, 316). Additionally, the parliament regulated how the people in the Elizabethan Era would dress according to their ranks. The laborers were not supposed to wear the clothes of the wealthy people in the society. Alternatively, the rulers imposed the sumptuary laws to control the people’s expenditure. The rulers applied these laws on aspects such as foods, jewelry, beverages, furniture, and clothing. The sumptuary laws were significant in controlling people behaviors and ensuring that specific classes structured remained the same. In most cases, the Elizabethan Sumptuary laws would decide on what clothing types and colors individuals would wear. This aspect was significant in identifying ranks and privileges in the kingdom. The Monarch was the ruling itself by Queen Elizabeth the first. This period was considered as England’s best monarch. During the Elizabethan Era, the Gentry were the squires, knights, women, and men who never worked with their hands. The men and the women in this category of people were considered gentle (Estep, 318). Alternatively, the Yeomanry was considered the middle class group of people who saved enough for a better life. This class included the tradesmen, farmers, and craft workers.
Work Cited
Estep, William R. Renaissance and Reformation. Grand Rapids, Mich: W.B. Eerdmans Pub. Co, 1986. Print.
Fix, Andrew C. The Renaissance, the Reformation and the Rise of Nations. Chantilly, VA: Teaching Co, 2005. Print.
Rowse, A L. The England of Elizabeth. Madison: University of Wisconsin Press, 2003. Print.
Another Bioinformatics Exercise A Distance Method of Inferring Phylogeny
Exercise 8: Another Bioinformatics Exercise: A Distance Method of Inferring Phylogeny
Names: ______________________________
In this activity, we will construct a phylogenetic tree using five homologous DNA sequences from primates. Because the sequences have been made up, we cannot deduce any real estimates of genetic distance; to create a meaningful phylogenetic tree from real data would require far longer sequences. Nonetheless, the fictional sequences (in Table 2 below) have been chosen to give a reasonably accurate picture of primate relationships based on genetic distance.
A tutorial similar to this exercise can be viewed at:
https://www.youtube.com/watch?v=09eD4A_HxVQ&ab_channel=OxfordAcademic%28OxfordUniversityPress%29
Table 1. DNA sequences of 6 species of primates
Primate Sequence
1 Neanderthal (n) TGGTCCTGCAGTCCTCTCCTGGCGCCCCGGGCGCGAGCGGTTGTCC
2 Human (h) TGGTCCTGCTGTCCTCTCCTGGCGCCCTGGGCGCGAGCGGATGTCC
3 Chimpanzee (c) TGATCCTGCAGTCCTCTTCTGGCGCCCTGGGCGCGTGCGGTTGTCC
4 Lowland Gorilla TGGACCTGCAGTCATCTTCTGCCCGCCCGAGCGCTTGCCGATGTCC
5 Mountain Gorilla (g) TGGACCTGCAGTCATCTTCTGCCCGCCCGAGCGCTTGCCGATGACC
6 Orangutan (o) ACAACCTGCACTCCTATTCTGCCGAGCCGGGCGCGTGGCAAAGTCC
Count or estimate the number of difference between and among different species of primates.
Table 2. Pairwise sequence differences between primates
Neanderthal
1 Human
2 Chimpanzee
3 Lowland Gorilla 4 Mountain Gorilla 5 Orangutan
6
1 Neanderthal
0 3 ? ? ? ?
2 Human 0 5 ? ? 15
3 Chimpanzee 0 11 ? ?
4 Lowland Gorilla 0 1 ?
5 Mountain Gorilla 0 ?
5 Orangutan 0
Based on the pairwise difference between two sequences, get the averages of the two most closely related taxa. This will give the proportional distance between the two sequences. These values will represent evolutionary distances. Based on the values you estimated in Table 1, construct a preliminary branches for the most closely related taxa
Table 2.
1/2 3 4/5
6
1/2 0
4 + 5/2 = 4.5 8 + 11/2 = 9.5 ?
3 0 ? ?
4/5 0 ?
6 0
Examine the new matrix (Table 2) and reconstruct a new matrix combing those pairs that are most closely related putative species. Estimate the average difference between each of the two closest sister taxa as given in the example. Draw a your phylogenetic tree below.
